Scientists create 'test-tube' sperm

[Marco]

UK scientists have announced that they've been able to create sperm from stem cells taken from a 5-day-old male embryo. If confirmed, the development is said to be predominantly focused on people with infertility problems, allowing humans to, for the first time, have (genetically linked) children in spite of the card they were dealt at birth.

 

 

 

Below is the basic process, as provided by the BBC;

 

 

 

[hide=Stem Cells and Development Journal]They began with stem cell lines derived from human embryos donated following IVF treatment.

 

 

 

The stem cells had been removed when the embryo was a few days old and were stored in tanks of liquid nitrogen.

 

 

 

The stem cells were brought to body temperature and put in a chemical mixture to encourage them to grow. They were "tagged" with a genetic marker which enabled the scientists to identify and separate so-called "germline" stem cells from which eggs and sperm are developed.

 

 

 

The male, XY stem cells underwent the crucial process of "meiosis" - halving the number of chromosomes. The process over creating and developing the sperm took four to six weeks.

 

 

 

The Newcastle team say the sperm were fully mature, mobile sperm and they have produced a video to back up the research.[/hide]

 

 

 

Judging by the articles and news reports I've read on the issue so far, many scientists are already claiming this to be one of the major medical breakthroughs of the decade.

 

Although the Newcastle scientists say that the technique is still several years away from perfection, as you may imagine, the findings raise a huge range of practical and moral implications. Understandably, the researchers have been quick to state the issue of creating sperm should be debated now, prior to any practical usage, because as it stands it would be illegal for the scientists to attempt to create any life from the sperm.

 

 

 

Although there are countless more implications from this research, I've put down a few of the major ones so as to spark up some discussions on Tip.it ;)

 

They're all practical issues, because God knows (hah!) that I don't give a damn about the many religious issues, but feel free to bring them up if you so choose to.

 

Also note; there are at least two other parallel experiments being conducted at the same time (by the same research team) aiming to look at how they can further their development into other areas:

 

1. Unlike the headline research (stem cells taken from male embryos), this experiment is using stem cells taken simply from male skin cells, thus eliminating the need for an embryo.

 

2. (Unconfirmed) Although preliminary studies have failed, there may still be an experiment looking into whether the stem cells of a female can be used in the creation of sperm.

 

 

 

 

 

Infertile adults having children;- The dangers of going against nature? Infertile men and women will have the ability to pass down their DNA onto children?

 

Redundant men?;- In theory, sperm can be made in the future from male stem cells frozen in the past, therefore meaning that future generations could all have a common, modern, single ancestor.

 

'Female sperm';- (the yet to be published study) What implications will be had from lower levels of testosterone in children created from the DNA of two women?

 

 

 

 

 

If you intend to respond to this, then I strongly suggest you read up on this some more, as what I've said in this post really isn't enough to gain a decent understanding of the topic, and of course if you have a minimal understanding of the topic then your response may invariably lack quality...

 

 

 

BBC - Scientists claim sperm 'first' + video

 

Independent - Scientists create test-tube sperm

[baalboy5]

 

Redundant men?;- In theory, sperm can be made in the future from male stem cells frozen in the past, therefore meaning that future generations could all have a common, modern, single ancestor.

 

 

 

 

 

 

This caught my attention. It seems too, how to put it, "All most have blue eyes and blonde hair" in the future. It also could be a good thing as some flaws and faults are inherited. If the single ancestor never had it, it be a less amount of worrying bout in the future.

[Brad25891]

Who would be the parents? :o

 

 

 

Physics teacher told us about this earlier today, seems pretty interesting, I wonder what else this could lead to apart form the farming of human beings xD

[AceSpitball]

Also if we could all be linked to one future ancestor then we would all have the same physical traits right? Therefore we can assume that racism can be put to an end too.

[mmmcannibalism]

This is rather impressive, but like any technology that lets infertile people have genetic children I have a certain distate for it. I do commend the scientists for pulling this off, but I have to wonder what the point is.

 

 

 

I never did understand why people are so obsessive about having children that share their bloodline. Seriously, if you adopt a kid from an orphanage or whatever they dont grow up into a homicidal maniac because their parents have different dna. /rant

 

 

 

In all seriousness the discovery is cool but I rather dislike the field; I wish more scientists would focus on "beneficial" research.

[spacheco]

old news. this is how bongo was born. :twss:

[fastortoise]

The idea of no longer needing men is flawed. Sure, we wouldn't need to be around to impregnate women and continue producing humans.. science can do that now. However, if you base the entire future generation of humans on a single male parent, there will be serious consenquences. Even if we select the most perfect male human to supply his stem cells, the next generation would all have the same DNA, nobody would survive even the simplest environmental change which would wipe out the entire human species.

 

 

 

Scientists obviously will never do this, since they have foresight. What bothers me is that we don't really need this technology. We have developed methods of injecting sperm cells directly into a female egg - men can be incompetantly infertile and they can still safely have children. This new study will help men that don't produce sperm (which I'm not even sure exists) have babies. I don't want to sound pessimistic, but it probably doesn't even work, and if it does, the rate of success will be less than 5%. So even though this technology will probably never be used with us humans, I suspect we still gained some knowledge about stem cells, which is always a good thing.

[Dizzle229]

Eh, it's interesting, but this in itself doesn't have much of a use. What's more important is what it could lead to.

[spacheco]

Eh, it's interesting, but this in itself doesn't have much of a use. What's more important is what it could lead to.

 

 

 

 

 

you can finally have kids :twss:

[22pepsi22]

Hmm. So they've invented an even harder way of having kids?

 

 

 

Yay? :?

[Sam]

It's great that they have done it, apart from the genetic and moral implications.

 

 

 

According to the Daily Mail newspaper today, it said that this could act as an IVF treatment for men.

[Dizzle229]

Eh, it's interesting, but this in itself doesn't have much of a use. What's more important is what it could lead to.

 

 

 

 

 

you can finally have kids :twss:

 

 

 

You're no longer allowed to talk to Lenin.

[Seraphi]

Eh, it's interesting, but this in itself doesn't have much of a use. What's more important is what it could lead to.

 

 

 

 

 

you can finally have kids :twss:

 

 

 

You're no longer allowed to talk to Lenin.

 

No longer allowed on this forum please.

 

 

 

Anyways, I really don't see what use this could have.

 

I mean, if you're infertile, instead of doing this and adding another human to the already overcrowded world, why not just adopt?

[sithlord_man]

All I can see from this is the world population about to grow in size a lot faster than normal now...For countries that are developed.

 

 

 

Its a break through for Science...but if it's put to use....the world population would likely grow at a faster rate...which isn't good.

[Skull]

I'd say it's a good thing. Not an amazing thing, but still. Passing along your own genetics is something every creature wants to do instinctively, so it's understandable why someone might want it over adoption.

[Screechingmu]

Now men have even less importance in the world. Woohoo!

[Guest User]

I find the fact that they were able to do this not surprising. I mean, it does happen naturally. If they are able to find a way to do this from female stem cells, however improbable, hopefully impossible, help us now.

[RichieMcD]

This is pretty interesting, it provides infertile couples on the man's behalf the chance to have a baby with both their biological profile. Not only that, but apparently the Male chromosome is dying out and the men could be "extinct" within 3000-4000 years apparently, so this could be a savior. I'd say it's more than realistic though that they'll find some way to fix the problem or we simply wont exist by then.

[mmmcannibalism]

I mean, if you're infertile, instead of doing this and adding another human to the already overcrowded world, why not just adopt?

 

 

 

People have a very stupid obsession with children that share their bloodline.

[Will H]

I mean, if you're infertile, instead of doing this and adding another human to the already overcrowded world, why not just adopt?

 

 

 

People have a very stupid obsession with children that share their bloodline.

 

That's a tad unhealthy. If someone can't have kids, then they can adopt. We actually need more infertile people who can fulfil this role, not less. I'm guessing they used a similar technique to cloning to do this, but with different cell types. If they did, this isn't exactly a breakthough, we knew this was possible.

 

 

 

This is pretty interesting, it provides infertile couples on the man's behalf the chance to have a baby with both their biological profile. Not only that, but apparently the Male chromosome is dying out and the men could be "extinct" within 3000-4000 years apparently, so this could be a savior. I'd say it's more than realistic though that they'll find some way to fix the problem or we simply wont exist by then.

 

A saviour from what? We're going to have problems with over-population, not under-population.

[fastortoise]

I mean, if you're infertile, instead of doing this and adding another human to the already overcrowded world, why not just adopt?

 

 

 

People have a very stupid obsession with children that share their bloodline.

 

That's a tad unhealthy. If someone can't have kids, then they can adopt. We actually need more infertile people who can fulfil this role, not less.

 

If you're going to point fingers, why not frown at those who are giving up kids for adoption in the first place? If people would stop being irresponsible and giving up their children, honest couples who want a child (just like all our parents) can have a baby without being scowled at for picking up some of societies' slack.

 

I'm guessing they used a similar technique to cloning to do this, but with different cell types. If they did, this isn't exactly a breakthough, we knew this was possible.

 

There's a lot the human body can do that still baffles scientists even today. Saying "NATURE DID IT FIRST!" is pretty crazy. For example, our 'heart cells' are important in research because we know they duplicate and replace old heart cells just like any other cell in our body, except it does so very slowly (about half are renewed in our lifetime). So if researchers found a way to speed up this process without creating some form of cardiovascular cancer, we could cure all cardiovascular known diseases. I'd call that a breakthrough even though we already know it happens.

[Furah]

Oh great, now the world shall be even more populated. :wall:

[archimage_a]

[hide=]

I mean, if you're infertile, instead of doing this and adding another human to the already overcrowded world, why not just adopt?

 

 

 

People have a very stupid obsession with children that share their bloodline.

 

That's a tad unhealthy. If someone can't have kids, then they can adopt. We actually need more infertile people who can fulfil this role, not less.

 

If you're going to point fingers, why not frown at those who are giving up kids for adoption in the first place? If people would stop being irresponsible and giving up their children, honest couples who want a child (just like all our parents) can have a baby without being scowled at for picking up some of societies' slack.

[/hide]

 

 

 

Yup thats a good idea.

 

"Hey look over there at those teenagers while I have a kid. Dear me, that girl got pregnate at 14, if only she had waited for that crippling accident to befall her at age 20, she would have the same treatment as me!"

 

 

 

I don't think anyone is saying that having a tonne of kids is a good idea, and I don't think anyone would say that adoption or abortion are good forms of contraceptive....I think what is being said is:

 

'Hey we have this problem and that problem and now we have another problem. Thanks science.'

 

 

 

Added to that it means that people who could not take care of their own bodies(people who became infertile from consuming massive amounts of alchol) can now have kids.

 

It means that you could, effectively, take a hair from someone, go to the clinic and bada bim bad boop you can have their child inside you.

 

"Excuse me, me and my husband(indicate random stranger with similarly coloured hair, or even just a photo and say they are dead) want to have a baby."

 

"Do you have any proof of marriage?"

 

"Yes (Produce a random marriage agreement and say they are your names)"

 

"Thanks, that will be 95 pence. We also have a deal on twins...."

 

"Well that sounds good."

 

 

 

Wow, a dishonest women now has a pair of children with good looks...guess where they are going...(Well lets thing, easily hire them out to abusers or place them in talent shows or any number of other thing... or even just claim benefits and child support.)

 

 

 

Or perhaps the man could abuse it. They marry someone rich, decide to have kids, hey wait a minute that doesn't look like me, I want a divorce, haha I have half their money.

 

 

 

We all seem to think that it would only ever be used for the good of mankind...then someone like Hitler comes along and breeds an army. Hey wait, this idea wasn't so good after all.

 

 

 

Or maybe they could bring back slavery, you just find a person who works hard, asks no questions and doesn't complain and harvest their skin, hair, whatever...You make 300 new slaves, find the best attributes and breed them, the next generation you have, say 650(Last generation and this generation, with twins and such), you take the best attributes and breed them...all the while you are creating thousands of domestic slaves who will wash, clean and whatever.

 

What would you need? Willing mothers, you could just go out and offer 300 young women the chance to earn shares in a exciting new business for 9 months work. Oh and one obediant male, hardly impossible (if uncommon) to find.

 

(Sell a few for running costs, I am sure you could find buyers for boys and girls with no past, no state records...no family to go looking for them...plus this first generation would not be so great for slaves, they would still have their disobediant mothers genes in them) For the next generation you just use the females you grew last time...wait until they are 14, 16 at push...or pretty much as soon as they reach fertility, that way you only have to pay for 300 proceedures. Wait nine months, wait a year to recover, refertilise, nine months, another year to recover, refertilise, and then sell at whatever age they are...anywhere from 16 to 20. Sell any that are not fertile or lose their babies, keep some of the infertile back to look after all the children/mothers. You have probably paid for the food, water and shelter, as well as the 300 procedures.

 

Plus you now have a sustainable income, producing say 1,000 slaves a year...Assuming there is nothing wrong with them you are talking around 100,000 pounds each...It makes sense for a business person, if you have to pay someone 15,000 pounds a year then in 20 years you have paid for 3 slaves, who will probably work until they are 60...thats about 45 years, 2222 pounds a year....plus they don't need dental, medical.... So you, the slave owner are making about 100,000,000 pounds, one hundred and sixty million US dollars, a year.

 

Lets say the Government takes a...90% 'Contravention of Human Rights Tax' you are still making over ten million pounds...Even if you fed them a good diet(which would be tax deductable) you are still making a tidy profit....Easily enough to start your own country (if you ignored the tax) few years, your population has swelled to 100,000 , 4,000 slaves per year...you educate a few hundred of the slaves, give them their freedom and their own slaves...you could easily build an entire country out of that.

 

How difficult would it be to set up a country that specialised in the production of Human beings...We already know that if it makes a profit most 'developed' countries will do nothing about it...Take Iraq, people living in fear, living in fear...living in fear....Hey wait the oil prices are going up! Quick we must save the Irean? Alpacas?....Something istarn....Whoever has the oil!!!

 

 

 

Maybe the government would organise some sort of protection for them, but realistically...with that sort of profit and the fact that these slaves will be happy to be exploited(In all honesty I am basising this arguement on them using someone like me as a template, someone who will serve the 'greater good' in any way they can, without being specifically educated in what that greater good is...Someone who is naturally happy to help other people at the expense of their own happiness.) , there is not a lot you can do to stop it

 

 

 

Unless of course you stop it before it happens...virtually impossible being that hundreds of people in this country grow drugs on a daily basis, as well as kidnapping and all that jazz...you only need a womb and a DNA sample...like getting a pot and a seed...

 

Lets say you start it like that...you are a single woman, you and a few of your friends who are all sick of men walking all over you decide to get your vengance. You hear about some obediance DNA going round, get some, get pregnate and soon you have 7 children between you.

 

Now you have a choice, do you sell them on straight away...there are virtually no records, no father to be concerned... or do you let them grow up, chose to homeschool them(if there are 7 mothers then presumably they could house share, 6 of them work while one stays at home. If the one who stays at home gets too attached to them then each parent has sole custody of their child so they just take them off of her...then say she kidnapped them after they sell the child on.

 

 

 

A less worldwide alternative is that they could be a mix up at the lab...hey why is my baby a different colour. All you would need is some racist(or incompetant) doctor doing the implant...instead of the father's DNA you inject some 'nice clean person's' DNA. Or better yet you build a DNA sample(in a couple of years) which has dominate 'Whatever trait you personally like'.

 

One action which messes up three lives.

 

Or some overzealous civil servant 'Wouldn't it just be easy if there were no more people with hayfever', 'Wouldn't it just be easier if there were no more fat people.'

 

Few months later they pass a law 'If your embryo has gene sequence ATATTAAATTAGCCGGGCCC then you will have it destroyed.'

 

And done, no more fat or hayfever people...unless they have it naturally, possible but it means you have to actually look after your body...What with the sudden increase in black market organs from that new 'Humanic country' there is no real point in looking after yourself, except to have kids...oh wait, no need to do that either.

 

Then they get clever...no more people with CF or MS, no more gay people, no more environmentalists. Suddenly the state has decreed that it is illegal to have natural born children because is transmits STDs, its a temporary ban and as a subsitute they are subsidising the procedure.

 

60 years on, well no one really wanted it back...they were too busy having infertile sex and getting designer babies.

 

 

 

 

 

The randomness of birth is the elementary check and balance that prevents one gene group destroying another completely, keeping diversity alive and kicking.

 

It means that fate is no longer in the hands of fate but in the hands to those who came before.

 

So parents who are ashamed of something can ask that it is specifically target.

 

Two, three generations and we have no gay people, no religious people, no fat people, no moral people, no ginger/brown haired people, no black or asian people, no one who has to worry about the future, no one to tell us we are doing a bad job, no free thought, and of course, no one who wants to have natural children.

 

 

 

Yes, we will live in such a utopia...A world where everyone mindlessly accepts their place and doesn't question, a world where you can have sex with whoever you want because you are made infertile at birth to ensure that no abberations sneak in...and all we had to do was destroy 95% of the worlds Genepool.

 

 

 

You say it won't happen....Look at plastic surgery, pioneered so that burns victims could lead normal lives(just like infertile people), but soon it became abused by people who didn't like the way they looked(People who don't want their children to suffer like they did), until finally we live in an age where they make TV shows about it(Imagine the TV possiblities 'The last natural birth', 'The last black man to die/be born', 'The life and times of Winston Smith, the last free thinker')

 

Or look at the Machine Gun...the weapon that would save thousands of lives because its raw killing power would stop people trying to start wars. Then they were used in WWI, mowing down line after line of man as he ran across the muddy field to take a trench. Now they are commonplace, killing people every day.

 

 

 

Anything that has the capacity to do great good also has the capacity to do great evil, and until science(religion....humanitity) learns that, we will keep finding new ways to destroy the future.

 

 

 

 

 

(This is just an observation(and I am probably missing something) but they did say they have made sperm from a MALE EMBRYO...So from something which was created by natural means of fertilisation...The only possible application of this would be to create successive generations(breeding) without actually having the animal/human be created. Proving that life starts at the embryonic stage, since it can now produce new life...)

[Furah]

Text.

 

Thanks, I hadn't thought of that.